logo
Mutation type
Mutation code
Description
Substitution
G31C
changing “G31” in original sequence to “C”.
AT30G
changing “A30T31” to “G”.
TGTGGGGTTAATCTGCCGCCGGAATGGGTAACCCA
GGAAATTTTT32GATGCTGCTGATAAATGCCCGATG
ACGCCTCCACATGTAAAACGT
Deletes a "C" at position 15.
Insertion
A32insT
inserting “T” behind “A32”
C31insCATCATCATCACAGCAGCGGCCATATCGAAG
GTCGT
inserting“CATCATCATCACAGCAGCGGCCATAT
CGAAGGTCGT” behind “C31”.
Deletion
GT30del
deleting “G30” and “T31”.
ATTTCCAATACAAGAGTTCCCTGAGGGATGGAGAG
GGGAATGTGGGCTATACGCGGTCGGATTCACAAA
ACGTGGGATTAGTGGAGCATCAATGGATGCAAAG
AGAATAGCTGAAGACATACACAAGTGTTGGAAA29del
deleting “A29” to “A164”.

[Monovalent cations] mM
   [Mg++ Conc]          mM
  [dNTP Conc]           mM
  [DMSO Conc]          mM